Джо Дэвис ::: Биография

МОНСТРЫ, КАРТЫ, СИГНАЛЫ И КОДЫ

Натурализм в искусстве
Многочисленные сохранившиеся наскальные рисунки и петроглифы эпохи неолита (изображения человека, животных, сцен войны и охоты) свидетельствуют о том, что стремление художника к натурализму зародилось практически одновременно с самыми первыми попытками художественного творчества. В искусстве древних цивилизаций Средиземноморья и Леванта можно выделить несколько этапов, характеризующих последовательный рост интереса людей к "истинному" познанию строения человеческого тела. Древние греки, достигнув определенной степени "истинности" в своих познаниях анатомических особенностей человека, обратили внимание уже на "сокровенные" тайны жизни. Они установили соотношения отдельных частей человеческого тела и вычислили т.н. "золотую пропорцию", принципы которой, в свою очередь, нашли широкое применение в математике, архитектуре и астрономии. Именно руководствуясь моделью "золотого сечения", Иоганн Кеплер (может быть, по наитию или счастливому стечению обстоятельств) создал удивительно точные астрономические таблицы и открыл законы движения планет вокруг Солнца.

Трансанимация в истории искусства (некоторые примеры)
Свидетельства о волшебных или божественных взаимопревращениях - "трансанимации" (от лат. animus - "душа", animatus - "одушевленный") всех форм живой и неживой материи - являются важной составной частью греко-романской и иудео-христианской традиций. Обе занимают исключительное место в хронике человеческого преклонения перед силой и могуществом энергии, разделяющей жизнь и смерть.

Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: bulatov@ncca.koenig.ru. Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004.

Архетипы Мумии, Человека-волка, Дракулы и Франкенштейна в сознании людей всегда занимали особое место благодаря их связям с потусторонними силами, что предполагало дополнительную власть над жизнью и смертью. Эта тема послужила отправной точкой для появления несметного количества произведений в области современного искусства, литературы и кинематографа.
В 1986 г. при помощи синтезированной ДНК и генетически модифицированных бактерий было создано первое художественное произведение.

Пришельцы и монстры
Наиболее ярким примером наличия "трансанимационных" верований в современной жизни можно считать организацию систематического научного поиска внеземного разума. Человеческим надеждам нет предела; мы полагаем, что даже если просто зададимся этим вопросом, уже сможем оживить целую вселенную. И здесь наше воображение идет проторенным путем, возвращаясь на круги давно известных тем. Массовая истерия, нагнетаемая СМИ по поводу похищений землян инопланетянами, красноречиво свидетельствует о том, что общественное сознание насквозь проникнуто проблемами сексуального характера, где страх и предвкушение сплетаются воедино.
Основа сюжетной интриги трансанимационных историй целиком выстраивается на отношениях сексуально-романтического свойства кошмарных чудищ с человеческими существами. И как всегда вдруг выясняется, что современные монстры - не что иное, как наши собственные отражения, родственные "классическим" чудовищам, уже архивированным в качестве примеров клинической патологии. Это вносит некоторую ясность в психологический портрет Капитана Кирка из "Звездного пути", периодически вступающего в романтические отношения с представительницами различных внеземных рас.
Казалось бы, комбинированные существа (по типу - полулюди-полуживотные) древнеегипетского пантеона, критский Минотавр, кентавры Греции и Рима предвосхитили призрак межвидового монстра, преследующего современное анти-генетическое лобби и активистов, озабоченных генетически модифицированными продуктами. Однако если вдуматься, идея химерности имеет гораздо более глубокие корни: межвидовые существа уже давно прописаны в нашей жизни в различных, порой даже неожиданных формах. Например, Homo sapiens имеет множество общих генов с остальным живым миром Земли. Мы, человеческие существа, независимо от того, насколько бы уникальными и одаренными себя ни воображали, имеем 70%-процентную гомологию наших генов генам помидоров (при этом сходство генов Homo sapiens, шимпанзе и человекообразных обезьян вообще приближается к 99%).
Не заметить тот факт, что пришельцы и монстры уже до отказа заполонили нашу планету, довольно легко. Они многочисленны, вездесущи, инкогнито и большинство из них имеет отношение к продуктам питания.
Начиная с доисторических этапов развития земледелия, человек только тем и занимался, что формировал геномы различных биологических видов в соответствии со своими генетическими предпочтениями. На сегодняшний день практически все виды, задействованные в сельскохозяйственном производстве, в той или иной степени претерпели изменения на генетическом уровне. В качестве иллюстрации достаточно взять самый обыкновенный помидор из магазина "натуральных продуктов" - "чистый" овощ, выращенный без использования пестицидов или химических удобрений. Но даже этот, на первый взгляд, "незапятнанный" биотехнологиями помидор в полной мере является "монстром" согласно словарному определению этого понятия. (Процитировать?). Современный томат обладает значительно бoльшим количеством копий хромосом, нежели его американские предки-ягоды с естественным набором. Дополнительные ДНК нынешних культур томата указывают на усиленную трансляцию генов, обусловившую гигантские размеры современного плода по сравнению с исходным. Итак, однажды, давным-давно, мы создали помидор-великан. При этом способ модификации плода не имеет принципиального значения, будь это традиционное садоводство, использование мутагенных агентов или рекомбинантные методы молекулярной биологии. Результат один и налицо: помидор - это "монстр". Просто большинство из нас об этом не догадывается.
Даже роза до известной степени - Франкенштейн, ибо ее геном состоит из частей и фрагментов геномной структуры множества других подвидов роз. Это же относится и к различным видам декоративных растений и несъедобных организмов, модифицированных Homo sapiens'ом для улучшения их эстетических свойств или при достижении каких-либо других целей.
На протяжении долгого времени человек был не только создателем такого рода чудовищ, но и самым настоящим "фагом" и/или потребителем своих творений. Одновременно с утолением голода он косвенным образом модифицировал и свой собственный организм. Сегодня, если бы мы употребляли в пищу "предков" тех видов животных и растений, которые едим в наше время, для выживания нашим организмам потребовалось бы серьезное генетическое "переоснащение". Нам пришлось бы просто дополнить свою "программу" фенотипами ранних гоминидов для того, чтобы обеспечить усвоение этой органики.
Сами толком не разобравшись, кто такие монстры, нынче мы уже вводим в заблуждение и Чужих на этот счет.

Поиск
Намеренно или нет, но в качестве "визитной карточки" нашего биологического вида мы отправляли в космос до странности некорректные изображения. Послания, выгравированные на позолоченных пластинах-носителях, были запущены за пределы солнечной системы при помощи межпланетных зондов "NASA Пионер" и "Вояджер". Эти эксперименты считаются первыми серьезными научными попытками установления контакта с внеземными цивилизациями.
"NASA Пионер" и "Вояджер", стартовавшие в начале и середине 70-х годов, смогли развить достаточную скорость, чтобы выйти за пределы солнечной системы при помощи гравитационного поля Юпитера. Это самые скоростные баллистические объекты, созданные на сегодняшний день руками человека: сейчас они удаляются от нас со скоростью около 50 тыс.км./час, что во много раз превышает скорость пули.
Пластины "Пионера" содержат набор визуальной информации, включающей элементарную карту солнечной системы, траекторию корабля, схему квазизвездных объектов, называемых "пульсарами" (нечто вроде путеводителя для любопытных инопланетян по окрестностям солнечной системы), изображение самого зонда "Пионер" и два контурных тиснения, символизирующих мужчину и женщину Homo sapiens. Обе фигуры представляют усредненный тип белого европеоидного человека без признаков растительности на лице или теле. Мужская фигура делает таинственный жест рукой с открытой ладонью вверх и имеет "должным образом" отображенные гениталии. Внешние половые органы женщины (фигурка размером поменьше) красноречиво отсутствуют.
Дабы усугубить ситуацию, при составлении посланий для двух зондов "Вояджер", последовавших за "Пионером" за пределы солнечной системы, NASA принимает решение полностью устранить даже эти изображения обнаженных человеческих существ. Естественно, что такая цензура вряд ли окажется в пользу пришельцев.
Об инопланетянах мы знаем совсем не много. Однако, если "разум" где-то и существует как биологическая форма, мы можем быть практически уверены в одном: разумные существа обладают половыми различиями, так как без обмена генетическим материалом они не могут эволюционировать. В 1958 году Джошуа Ледерберг получил Нобелевскую премию за открытие половых различий у бактерий.
Так, намеренно или волею судеб, мы умудрились отправить во Вселенную несколько посланий, которые чрезвычайно выразительно характеризуют нашу собственную предвзятость. Очевидные информационные пробелы в наших межзвездных посланиях наводят на мысль, что инопланетяне не имеют права знать, как мы выглядим. Может быть, именно поэтому нам не стоит так скептически относиться к сообщениям о похищениях людей пришельцами для экспериментов с их половыми органами?
Наверное, это к лучшему, что одни из самых быстроходных космических кораблей в истории человечества, передвигающиеся со скоростью около 50 тыс.км./час, достигнут ближайшей звезды лишь через 100 000 лет. Ведь кроме рассылки позолоченных "бандеролей" существует и более эффективный способ доставки космических посланий.
В 1974 году астрономы Фрэнк Дрейк и Карл Саган предприняли попытку передать на скорости света трехминутное сообщение в созвездие Геркулеса. Для этого они использовали уникальный параболический радиотелескоп мощностью миллион ватт, установленный в Аресибо, Пуэрто-Рико.
Дрейк и Саган были убеждены, что именно двоичная система, благодаря своей простоте, должна быть наиболее распространенной формой квантования. Астрономы руководствовались тем, что если инопланетяне имеют представление о математике, им известны простые числа и так называемые "числа Цермело". Это ряд чисел, например, 35, которые делятся только на самих себя, 1 и два простых множителя (в нашем случае 5 и 7).
При помощи радиотелескопа в Аресибо Дрейк и Саган передали 1679 нолей и единиц ("on" и "off"). 1679 - число Цермело, которое можно разложить только на него самого, единицу и простые множители 23 и 73. Таким образом, разумные инопланетяне могли бы сделать вывод, что поток 1679 бит должен составлять растровую сетку 23 на 73. Если придать "нулям" и "единицам" контрастные значения (например, "светлое" и "темное"), тогда в одном из нескольких возможных разложений потока в такую сетку появляется некое заданное изображение. Очередное допущение предполагало, что инопланетные коллеги истолкуют полученный рисунок именно так, как это было задумано земными авторами.


Interplanetary probe Pioneer message plaque.

Подобно пластинам "Пионера", зашифрованное послание Дрейка и Сагана содержало изображение средства передачи сообщения (параболическая радиоантенна), простейшую карту солнечной системы и силуэт человека. Радиоинформация из Аресибо также включала в себя схему правосторонней спирали ДНК, атомный вес пяти составляющих ее химических элементов, точное число оснований ДНК генома человека и численность населения Земли на 1974 год.


Launched in the early 1970's, NASA's Pioneer spacecraft acheived enough velocity to escape the solar system with an the assistance of the Jovian gravitaional field.

Послание в разных бутылках
Вдохновившись аресибским экспериментом, я решил проверить эффективность подобного послания посредством инсталляции, которую выстроил в библиотеке Хайден Массачусетского технологического института (1989 г.). Художественное произведение под названием "Послание в разных бутылках" состояло из 1679 стеклянных бутылок Boston Round (16 унций), закрепленных в больших каркасах, и занимало 18 проходов книгохранилища, находящегося в подвале. Как и положено, "единицы" были наполнены водой, а "нули" - пустые. Хейден - одна из крупнейших библиотек Массачусетского технологического института. В ней есть вся информация, имеющая отношение к посланию, вся информация, необходимая для расшифровки послания, и, кроме того, ее часто посещают наиболее разумные из земных существ. Никто из них мое послание так и не расшифровал.
Послания человека для установления контакта с внеземным разумом обладают обширным контекстом, однако в то же время они должны говорить и сами за себя. Аристотель понимал, что мы обязаны раскрыть самих себя самим себе прежде, чем раскрывать себя кому-либо другому. В "Поэтике" Аристотель назвал проблему самораскрытия основным элементом поэтики трагедии. Он дал этому принципу название "узнавание" ("переход от незнания к знанию"), который наряду с другим конструктивным моментом - "перепетией" - формирует сам предмет изображения трагедии. Действительно, зависимость трагедийного предмета от механизмов "узнавания" и "перепетии" определенно прослеживается на протяжении всей истории искусства и литературы.
Проще говоря, "Ты обходишь всю Землю в поисках Чаши Грааля. По пути ты убиваешь собственную мать, попадаешь в тошнотворные переделки, претерпеваешь невыносимые мучения и тяжкие страдания. А в результате обнаруживаешь, что Чаша Грааля все это время находилась у тебя за пазухой". Это история "Джекила и Хайда". Это "Моби Дик", "Эдип", "Возвращение Мартина Герра", "Фицкаральдо", "Волшебник Изумрудного Города", "Быть Джоном Малковичем".
И опять же - "другой" неотвратимо присутствует внутри. Куда бы мы ни пошли, что бы мы ни увидели, независимо, как далеко от мира, - мы находим только отражения. По Аристотелю, когда мы, в конце концов, доберемся до края Вселенной, то, вынырнув вниз головой, обнаружим, что там на стене отпечатана все та же кора головного мозга человека.
Ученые, озабоченные поисками внеземного разума, продолжают старательно разрабатывать сложнейшие, детальные, но с практической точки зрения неприменимые цифровые сообщения для передачи по радиотелескопу иным цивилизациям. Универсальность языка, основанного на двоичном коде, вызывает сомнения по нескольким причинам. Во-первых, мы, создания билатерально* симметричные, существуем в мире множеством других симметрий. Мы погружены в традиции когнитивной дихотомии: правое и левое, позитив и негатив, правда и ложь, добро и зло. Если бы мы были радиально симметричными, то "универсальной" считали бы совсем иную форму математической экспрессии.


Frank Drake and Carl Sagan decided to use the million-watt radar transmitter at Arecibo, Puerto Rico to beam their message.

Во-вторых, ноль был изобретен на нашей планете всего около тысячи лет назад. Вполне возможно, что очень разумные существа, построившие в разное время Парфенон, акведуки и пирамиды, создавшие карты звездного неба и измерившие окружность Земли, сделали все это вовсе без нуля.
И еще одно необоснованное предубеждение: ученые, полностью полагаясь на визуальную информацию (растровый массив или информационные пластины) как надежное средство межпланетной коммуникации, исходят из того, что инопланетяне обладают зрительными органами, способными воспринимать их послания. А наш земляк Кент Каллерс, сотрудник Института поиска внеземных цивилизаций в Калифорнии, много лет проработавший в NASA в поисках внеземного разума, - слеп.

Poetica Vaginal
В 1986 году, в целях установления контакта с внеземным разумом я организовал художественный проект, в рамках которого была сделана попытка передачи вагинальных сокращений в космос. Проект назывался "Poetica Vaginal". В нем участвовали художники, инженеры, электрики, биологи, астрономы, профессиональные танцоры, архитекторы, лингвисты и философы.
В лаборатории приборостроения МТИ был создан так называемый "вагинальный детектор". Он состоял из заполненной водой пластиковой пробирки центрифугирования, установленной на жестком нейлоновом основании, содержавшем сверхчувствительный датчик. Приглашенные участники эксперимента - танцовщицы и другие женщины-волонтеры, соблюдая необходимые гигиенические нормы, инвагинировали детектор в целях регистрации вагинальных сокращений (наиболее высокая частота была зафиксирована на уровне 0,8 Hz). Установленный датчик обладал достаточной чувствительностью, чтобы уловить голос, биение сердца и дыхание, а также произвольные и непроизвольные вагинальные сокращения.
Гармонические колебания вагинальных сокращений в реальном времени сопровождались трансляцией музыкальных композиций для того, чтобы частота сокращений совпала с конкретными частотами английской речи. Филолог, принимавший участие в проекте, "забитовал" звуковой строй языка (фонемы) таким образом, чтобы их можно было отобразить в реальном времени в соответствии с вагинальным "входным сигналом". Цифровое картирование выходного сигнала детектора осуществлялось в режиме реального времени. Таким образом, одновременно выходило три формы послания: 1) аналоговый сигнал, непосредственно генерированный вагинальными сокращениями; 2) цифровая карта этого явления и 3) голос ("фонетическая" карта вагинальных сокращений на частотах английского языка).
Электрики выстроили управляющую цепь таким образом, чтобы "Poetica Vaginal" можно было транслировать через миллион ваттный Мильстонский радар Массачусетского технологического института, находящийся в обсерватории Хейстек (Гротон/Вестфорд, Массачусетс). Художники, архитекторы и инженеры обеспечили электронный и ручной контроль передачи сигнала "Модуля вагинального путешествия". Благодаря совместным стараниям участников проекта складная конструкция из стали, дерева, кабелей и упаковочного материала в результате выглядела как индейская баня, установленная на космическом модуле, спускаемом на Марс.




Artistic work constructed from synthetic molecules of DNA. The first of these artistic molecules, Microvenus, contains a coded visual icon representing the external female genitalia and by coincidence, an ancient Germanic rune representing the female Earth.

Астрономы и астрофизики выбрали 4 ближайших звездных аналога Солнца: Эпсилон Эридани, Тау Цети и две безымянные, обозначенные номерами каталога Королевской Гринвичской Обсерватории. Все они расположены на расстоянии от 10 до 40 световых лет от Земли. Координаты космических объектов были высчитаны таким образом, чтобы на них можно было направить радарный сигнал. Сам модуль был собран на площадке Обсерватории, где и прошла предварительная пробная передача вагинальных сигналов с одновременной их записью на аудиокассету. Однако накануне начала радиотрансляции "в живую" руководитель проекта, полковник ВВС США (Массачусетский институт заключил контракт с ВВС), наложил запрет на проведение работ… И все же нам удалось в течение нескольких минут осуществить передачу пробных сигналов на каждую из четырех звезд.

Тихоходы и другие проблемы
Сложности возникают не только при выполнении экспериментов на космических кораблях, но и при передаче сигнала через радиолокатор. В космосе нет мощных радиолокационных передатчиков, поэтому сигнал должен быть максимально сфокусирован для эффективного преодоления атмосферного "окна", насыщенного мельчайшими пылевыми частицами. Это значительно сужает диапазон частот передачи.

Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: bulatov@ncca.koenig.ru. Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004.

По причине технических ограничений радиолокационный сигнал может быть единовременно передан только на одну звезду. Для сравнения отметим, что только во Млечном Пути звезд больше, чем рыбы в океане. Предположим, мы решили выйти на рыбалку примерно на три минуты, питая большие надежды на успех. При этом наша оснастка рассчитана на поимку одной конкретной рыбы из всей океанской фауны. Понятно, что шансы у нас минимальны.
Самая большая проблема при передаче высокоскоростных посланий внеземному разуму заключаются в том, что в этой ситуации не хватает даже скорости света. Диаметр Млечного Пути составляет около 100 000 световых лет. Путешествие от одной стороны галактики до другой и обратно на скорости света займет 200 000 лет. Митохондриальная Ева (от которой по некоторым данным произошли все человеческие существа) жила примерно 200 000 лет назад. Если бы у нее оказалось оборудование для передачи сигнала достаточной мощности и на нужной частоте на другую сторону нашей галактики, и этот сигнал был бы принят в нужный момент 100 000 лет назад внеземным разумом, который незамедлительно ответил, - то его послание еще в пути. Тем временем Ева благополучно эволюционирует в другие виды. Кстати, может быть, митохондриальная Ева вовсе не была Homo Sapiens.
Радиолокационная антенна в Аресибо не обладает маневренностью, так как она встроена в полусферическую впадину кратера потухшего вулкана. Таким образом, окно выхода ее сигнала ограничено. Сагану и Дрейку пришлось выбирать цель из тех звезд, которые появлялись в этом окне в момент передачи космического послания. В результате послание из Аресибо было направлено на звездный кластер М13 в созвездии Геркулеса, находящегося на расстоянии примерно 25 000 световых лет. Итак, мы оказались в положении жениха с букетом цветов, ждущего в церкви свою невесту вот уже 50 000 лет: она все идет, идет и идет к нему, а он все ждет, ждет и ждет, чтобы сорвать с нее покров невинности. Воистину печальная картина...
Помимо проблем с содержанием послания существует три основных технических сложности, которые возникают в каждом экспериментальном проекте по межзвездной коммуникации. Во-первых, для миллиардов потенциальных получателей сообщения необходимо создать миллиарды копий послания. Во-вторых, носитель должен быть достаточно прочным, чтобы выдержать жесткие условия космической среды, включая экстремальные температуры, радиацию и вакуум. В-третьих, целостность носителя из практических соображений не должна быть нарушаема в течение неограниченного периода времени (по крайней мере, периода, соразмерного с нашим понятием "геологического времени").
Эти проблемы связывают в одно целое безмерность макрокосмоса и бесконечную малость микрокосмоса и именно они вдохновили меня на первые художественные проекты в области молекулярной биологии. Так получилось, что только бактерии, особенно спорулирующие, замечательным образом отвечают всем выдвигаемым техническим требованиям. Они могут длительное, даже неограниченное время выживать в космических условиях. Кроме того, за один день можно без особых усилий и затрат произвести миллиарды идентичных копий одной бактерии.

Микровенус
В 1986 году два участника проекта "Poetica Vaginal" (я и Дана Бойд, генетик из Гарварда и молекулярный биолог) решили создать модельный бактериальный носитель интеллектуальной информации человека. Эта работа, которую мы назвали "Микровенус", стала первым произведением, созданным непосредственно в форме ДНК при помощи рекомбинантных механизмов молекулярной биологии. (Дэвис, 1996) "Микровенус" представляет собой графический символ (наподобие наложенных друг на друга букв "Y" и "I"), закодированный в нуклеотидную последовательность ДНК. Эта последовательность была синтезирована в Гарварде при участии Мартина Боттфилда; полученные синтетические олигонуклеотиды очищены Даной Бойд в Беркли и затем в Гарварде легированы с плазмидными векторами pUC19 и pSK-M13+. В результате лабораторные штаммы бактерии E. coli были трансформированы рекомбинантными плазмидами, содержащими заданный синтетический фрагмент.
"Микровенус" стала первой из целого ряда художественных работ, созданных с привлечением стремительно развивающихся технологий и направленных на исследование возможностей кодирования необходимой информации в ДНК. Для того чтобы закодировать выбранный графический знак, мы задали ряд фазовых значений, соответствующих каждому из четырех оснований ДНК (C=x; T=xx; A=xxx; G=xxxx). Данный метод мы совместили с растровой технологией изображения на основе чисел Цермело, использованной Дрейком и Саганом при составлении послания Аресибо. "Микровенус" была закодирована в 35-битный (7 на 5) растр Цермело в следующей последовательности:

10101
01110
00100
00100
00100
00100






Art work allows the user to listen particular living cells microacoustic signatures


Используя заданные фазовые значения четырех оснований ДНК, число, составляющее данный растр, можно отобразить следующим образом: "CCCCCCAACGCGCGCGCT". Первый двоичный знак слева (верхний ряд) выражается символом "С", потому что это число имеет одну фазу (так как не повторяется непосредственно сразу). До перехода в следующий двоичный знак оно остается в своем значении ("1") один раз. Второй, третий и четвертый знак во втором ряду можно отобразить в качестве основания "А", так как это число ("1") повторяется три раза до перехода в следующий знак. Потом снова идут "А" и "С", а следующие четыре двоичных знака отображаются как "G" и т.д. Таким образом, 35-битовый растр "Микровенус" кодируется в 18 оснований ДНК. Мы также добавили короткую последовательность "CTTAAAGGGG" в качестве декодирующего ключа (относительно заданных фазовых значений оснований ДНК). В результате комбинированная последовательность ДНК "Микровенус" выглядит следующим образом: "CTTAAAGGGGCCCCCCAACGCGCGCGCT".
Символ "Микровенус" представляет собой одновременно древнегерманский рунический знак, обозначающий женскую природу Земли и графическое изображение гениталий, которое до сих пор отсутствовало в посланиях внеземным цивилизациям. Поскольку для распространения бактерий "Микровенус" в космосе не было выделено необходимых финансовых средств, проблема заражения внеземной среды земными бактериями не рассматривалась. Однако именно эти бактерии - видимо, в качестве спор Bacillus, - обладают значительными преимуществами перед стационарными (радар) и передвижными (космический корабль) вариантами отправки внеземных сообщений.
Независимо от вероятности распространения "Микровенус" или любой другой бактерии-носителя в космосе, загрязнение внеземной среды в настоящее время представляется неизбежным. Звучит забавно, но все космические аппараты, находившиеся в разное время на орбите - Mercury, Gemini, Apollo, Skylab, Space Shuttle - сбрасывали отходы жизнедеятельности человека непосредственно в космос. Они буквальным образом смывали туда свои туалеты. Исследователи космической пыли жалуются на то, что в поисках частиц из внеземного пространства им приходится просеивать остатки мочи и кала астронавтов (во всяком случае, они совпали с лабораторными образцами таковых). А на корабле Space Shuttle вообще пришлось счищать фекалии прямо с иллюминатора.
Я воспользовался "поэтическим правом" и назвал эти кольца из замороженных отходов, опоясывающие Землю, "Кольцами Нортона" (для формирования колец, подобных тем, которые опоясывают Сатурн, планетарный объект должен обладать естественными спутниками). Название "Нортон" возникло по ассоциации с ассенизатором Эдом Нортоном, персонажем телевизионного сериала 50-х "Медовый месяц".

Загадки жизни
В начале 1990-х я выяснил, что еще за 30 лет до создания организма "Микровенус" ученые предпринимали попытки записи посланий в форме ДНК. В двух книгах (Ernst and Lipson, 1988 и Beadle and Baedle, 1966) я нашел краткие упоминания этих малоизвестных эпизодов истории науки. Дело происходило в 1958 году. За пять лет до этого Уотсон и Крик (при участии Розалин Франклин) предложили структурную модель ДНК, но прошло еще десять лет, прежде чем ученым удалось понять устройство генетического кода.
Было известно, что аминокислоты кодируются в ДНК кодонами-триплетами, но принципы распределения двадцати аминокислот между 64 возможными нуклеоидными триплетами были открыты только в 1967 году. На промежуточном этапе биологи осознали, что функциональный принцип генетического кода во многом схож с функциональным принципом речи. Триплет-кодон имеет такое же отношение к аминокислоте, которую он представляет, как, например, слово "красный" к феномену или способу восприятия красного цвета. Таким образом, генетический код функционирует так же, как язык в формальном, лингвистическом смысле. Выяснив это, ученые почувствовали себя лириками. В биологических кулуарах несколько лет обсуждался вопрос о том, существуют ли между "словами" "пробелы". Биологи обозначили две противоположных точки зрения - одни придерживались мнения, что код подразумевает наличие "запятой", другие полагали, что нет. Наука в очередной раз достигла своего предела понимания и обнаружила, что там отразился ее собственный язык.
В 1958 году, в преддверии церемонии вручения Нобелевской премии в Стокгольме, два ученых - Макс Дельбрюк и Джордж Бидл - обменялись несколькими шифрованными посланиями, построенными по принципу лингвистического функционирования генетического кода. Они заменили буквы английского алфавита позициями аминокислот в коде из 64 элементов (рис. 1). Сообщения Дельбрюка содержали кодоны, соответствующие "запятым" или "пробелам". Бидл придерживался принципа "без запятой".
Последним в их "переписке" стало сообщение в форме модели ДНК, собранной из 174 зубочисток разных цветов. Дельбрюк привез модель в Стокгольм, а Бидл расшифровал этот текст во время своей официальной лекции по поводу вручения Нобелевской премии. В модели было зашифровано следующее сообщение: "Я - загадка жизни, познайте меня, и вы познаете себя".
Это была "загадка Сфинкса". "Познай самого себя" - известное изречение Аполлона и принцип Дельфийского оракула. Вот почему Сократ так упорно пытался убедить Афины, что он ничего не знает (немало поспособствовав тем самым своей гибели).


Fig.1. Delbruck Riddle of Life RNA code (ABCD=UCAG).

В 1995 году мне пришла в голову идея организовать выставку о "Загадке жизни" в гарвардском Бойлстон Холле. (Надис 1995) Основным ее экспонатом должна была стать модель ДНК 174 "Загадка жизни". В 1958 г. Дельбрюк и Бидл не могли синтезировать реальную ДНК. Фактически, синтез ДНК давался нелегко до середины 80-х, а синтезировать такую большую молекулу, как ДНК 174 "Загадка жизни", было бы довольно сложно без применения полимеразной цепной реакции - метода, который стал доступен биологам только около двух десятилетий назад.
Зимой 1993-94 гг. я договорился о проведении работ по синтезу и очистке ДНК "Загадка жизни" в лаборатории Бурхарда Виттига (Свободный университет, Берлин). После этого (1994 г.) мы, совместно со Стефаном Волфлом, собрали и клонировали олигонуклеотиды "Загадки жизни" в бактериях E. coli в лаборатории Александра Рича (Массачусетский технологический институт). Со своей стороны Гарвардский и Кембриджский (Массачусетс) комитеты по биобезопасности дали официальное разрешение на хранение бактерий "Загадка жизни" в рефрижераторе с двойным остеклением, который был специально для этой цели установлен в гарвардском Бойлстон Холле. Накануне выставки журнал "Nature" опубликовал пространную статью о проекте "Загадка жизни", где в частности говорилось о том, что нам удалось выстроить "мост между двумя культурами" науки и искусства. К сожалению, перейти этот мост нам не удалось. (Nadis 1995)

Нормы и требования производства и экспозиции генетического искусства
В самую последнюю минуту Гарвардский комитет по биобезопасности отозвал свое разрешение на размещение бактерии E. coli "Загадка жизни" в рефрижераторе Бойлстон Холла. Решение было принято, несмотря на недавнюю публикацию в журнале "Scientific American" в разделе "Сделай сам" руководства для исследователей-любителей по получению рекомбинантной E. coli в домашнем аквариуме при помощи лампового инкубатора.
Генетически модифицированные организмы "Загадка жизни" были выставлены для публичного обозрения только пять лет спустя на фестивале современного искусства "Ars Electronica" в Линце (Австрия, 2000). (Nadis 2000) Разумеется, были предприняты все необходимые меры биологической и физической защиты под контролем и с разрешения представителей Австрийского комитета биологической безопасности.
Художники, работающие с ДНК живых организмов, непременно сталкиваются с большим кругом различных организационных вопросов, касающихся как проблем технического, архитектурного и т.п. характера, так и положений биологической безопасности и контроля состояния окружающей среды, связанных с организацией выставок рекомбинантных организмов. Это в полной мере относится и к деятельности кураторов, устраивающих подобные выставки в общественно доступных местах. Зачастую директоры галерей и музеев не могут или не хотят преодолевать все сложности, возникающие при размещении и публичной демонстрации объектов генетического искусства. Однако проблемы, связанные с безопасностью и ответственностью, все же необходимо решать, если мы хотим адекватно представлять развитие этого художественного направления. Отдельный пункт в организации таких выставок занимает серьезная подготовительная работа с публикой (имея в виду непреходящую массовую истерию по поводу генетических манипуляций), а также с институтами, формирующими общественное мнение по данному вопросу.

Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: bulatov@ncca.koenig.ru. Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004.

Любые газы, контактирующие с этими организмами (включая атмосферный воздух), на выходе из здания сжигаются. Таким образом сгорают все патогенные организмы, переносимые воздушным путем.






Joe Davis, Katie Egan. Artistic Molecules & Audio Microscope (installation fragment), 2000. Photo by S. Starmayr. Art work constructed from synthetic molecules of DNA: Audio Microscope allows the user to image particular living cells while simultaneously listening to their greatly amplified - and species-specific - microacoustic signatures. The project Riddle of Life, which likewise works with sequencing and back-translation, takes the poetic message "I am the riddle of life. Know me and you will know yourself."

Но правила обращения с самым опасным живым организмом на Земле имеют свои особенности. Этот организм, уничтожающий по одному биологическому виду ежедневно (а некоторые утверждают, что по одному виду в минуту), называется, конечно, Homo sapiens. Никаких норм по контролю над самими биологами до сих пор не принято.
В данной ситуации неважно, насколько биологи придерживаются правил биобезопасности, - художники должны соблюдать их неукоснительным образом. На сегодняшний день не существует никаких специальных норм или протоколов по размещению и контролю организмов, используемых для создания произведений генетического искусства. В итоге многие ученые полагают, что только научные работники умеют должным образом обращаться с рекомбинантным материалом. Однако на самом деле наука не имеет эксклюзивного права на ответственный подход к делу. Нынче художники находятся в полной зависимости от научных лабораторий, так как не могут осуществлять свои творческие замыслы без специального оборудования: к сожалению, независимых лабораторий, производящих рекомбинантные организмы исключительно в художественных целях, пока не существует. Ответственность за распространение организмов вне лаборатории, как правило, лежит на самой лаборатории, которая произвела эти организмы. Поэтому художник также должен быть готов столкнуться с определенными опасениями ученых в отношении осуществления своего генетического проекта. Более того, совершенно очевидно, что художник, работающий в научной лаборатории, должен безоговорочно соблюдать все нормы и правила, иначе доступ к необходимому оборудованию будет для него закрыт.


Fig. 2. Key for a Base-20 Degenerate DNA Supercode.

Геномное искусство
За относительно небольшой промежуток времени художники перешли от традиций подражательного воспроизведения реальности к непосредственному манипулированию жизнью. В настоящий момент художественная работа определяется на уровне манипуляций одинарными генами (или их эквивалентами), их экспрессии или размещения в организме-"хозяине".
По мере развития самой технологии и понимания сути генетики художники будут более обстоятельно осваивать технический инструментарий и овладевать набором методов молекулярной генетики и биологии. В ближайшем будущем уже появятся художественные произведения, созданные на основе нескольких генов и даже генома в целом.
Геном - это крупный резервуар высокоорганизованной информации, обладающий сложной встроенной или самообразующейся системой интерпретации и анализа данных. Поскольку эта система состоит из белков и нуклеиновых кислот, она действует на таком уровне сложности, который не учитывают математические операции, используемые для управления традиционными базами данных.
Художественное произведение, состоящее из больших случайно составленных последовательностей ДНК, невозможно автоматически воспроизвести in vivo. Большое число простых повторов одной или нескольких пар оснований ДНК биологически нестабильно. Некоторые последовательности могут обладать свойствами, не только нарушающими стабильность, но и токсичными для клетки-хозяина.
Геномное искусство (и даже генетическое искусство) должно обладать способностью кодировать большой объем произвольной информации в "биологически-благоприятные" молекулы ДНК. Для этого существуют суперкоды ДНК.


Joe Davis. She (DNA) is the Primordial Venus. DNAgraphy, 2002. Microscopic images created with biochip technology (Clondiag Biochip Technologies GmbH, Jena) using DNA as photographic "emulsion". The technique allows for photography much as we think of it, but at extremely high resolution. The images are smaller than 1.0 mm.

Суперкоды и ДНК "Млечного Пути"
Впервые я разработал суперкод ДНК (рис. 2) в 1995 г. для кодировки карты галактики Млечного Пути в молекулу ДНК. (Davis 2000)

Карта Млечного Пути представляет собой цифровой файл объемом 1,1 килобайт, содержащий исследовательскую космическую карту Млечного Пути NASA (NASA COBE), которую можно представить в виде последовательности двоичных цифр.
В данном суперкоде для транскрибирования 20 оснований, посредством которых кодируются входные данные (в нашем случае карта COBE), использовано большинство из 64 нуклеотидных триплет. Второй этап кодирования существует для решения биологических проблем, связанных с вводом произвольных данных непосредственно в ДНК. Три стоп-кодона (ТАА, TАG, TGA) представляют собой "переключатели" между различными модулями кодирования, а также устанавливают мононуклеотидные простые повторы, встречающиеся во входных данных. Четыре мононуклеотидных триплета (CCC, TTT, AAA, GGG) определяют соответствующие основания ДНК (C, T, A, G).
Суперкод ДНК имеет три последовательности кодирования: 1) TGA используется для обозначения биологически совместимых сегментов вводимых данных, кодируемых непосредственно в ДНК; 2) ТАА используется для обозначения мононуклеоидных повторов, где триплет, инициирующий базовое основание 20, предшествует одному из триплетов, определяющих конкретное основание ДНК; 3) TAG - не кодирующая, "бессмысленная" последовательность, указывающая на то, что она не содержит вводимых данных. Последовательность TAG может содержать участки узнавания в энзимах, необходимые для манипуляции и составления полной последовательности, либо для ввода функциональных генов в целях обеспечения стабильности собранной последовательности in vivo.
На первом этапе суперкодирования имеющейся базы данных последовательность ТАА кодирует все стоп-кодоны вводимых данных, которые были непосредственно транскрибированы в ДНК. Все кодоны терминации, введенные в качестве элементов-переключателей последовательности суперкода, будут стерты в процессе декодирования. Кодоны инициации (ATC, GTG, TTG, CTG и т.д.) трансляции вводимых данных биологической структурой клетки хозяина могут быть также зашифрованы в целях предотвращения нежелательного выражения in vivo.
Суперкод, как и сам генетический код, является вырожденным с тем, чтобы генерировать большое число последовательностей ДНК, каждую из которых можно было бы декодировать в точном соответствии с исходными данными. Например, в случае ДНК "Млечного Пути", можно генерировать гораздо большее число последовательностей, содержащих карту галактики, чем число звезд, находящихся в самой галактике.
На идею создания ДНК "Млечного Пути" меня натолкнула детская сказка об избалованной девочке, которая не могла найти свое счастье, пока не встретила мышку с картой мира в ушке.
Первая ДНК "Млечного Пути" была синтезирована в 2002 г. и представлена на художественной выставке "Biologia Como Arte" (Queiroz 2002) в Баркарене, Португалия. Полная последовательность ДНК "Млечного Пути" состоит из 3867 bp молекул ДНК, что превышает размеры ряда плазмид и соответствует размеру некоторых вирусных геномов (например, вирус Phi-X содержит около 5000 пар оснований).**

Код умолчания
Суперкод ДНК решает многие проблемы, связанные с кодированием объемных баз данных в ДНК, кроме одной и очень серьезной. Организм обычно стремится стереть последовательность ДНК, не обладающую выраженным биологическим смыслом.
Вместе с Даной Бойд мы создали код следующего поколения, названный "Код умолчания", который использует вырожденный генетический код для ввода произвольной информации в генную последовательность, не изменяя при этом биологического транскрипта этого гена.

Данная электронная версия книги "Биомедиале. Современное общество и геномная культура" не полна. Текст без пропусков может быть приобретен в печатной форме в виде антологии. Запрос направлять по адресу: 236000, Россия, г. Калининград, ул. К.Маркса, 18, по телефонам: Калининград (0112)216251, Санкт-Петербург (812)3885881, Москва (095)2867666. Электронный магазин: http://www.yantskaz.ru, Книга-почтой: тел.(0112)216251, все справки по электронному адресу: bulatov@ncca.koenig.ru. Полная ссылка на данную книгу: "Биомедиале. Современное общество и геномная культура". Составление и общая редакция Дмитрия Булатова. Калининград: КФ ГЦСИ, ФГУИПП «Янтарный сказ», 2004.

Кодоны терминации (TAA, TGA и TAG) и одинарные кодоновые последовательности для метионина и триптофана (ATG и TGG) в "Коде умолчания" не используются (рис. 3).

Рис. 3. Код умолчания.

amino acid [codon = silent code value]

1) PHE = [ UUU = 0, UUC = 1]
2) LEU = [UUA= 0, UUG = 1; CUU = 10; CUC = 11; CUA = 00; CUG = 01]
3) ILEU = [AUU = 0; AUC = 1; AUA = 00]
-) MET = [AUG = X]
4) VAL = [GUU = 0; GUC = 1; GUA = 10; GUG = 11]
5) SER = [AGU = 0; AGC = 1; UCU = 10; UCC = 11; UCA = 00; UCG = 01]
6) PRO = [CCU = 0; CCC = 1; CCA = 10; CCG = 11]
7) THR = [ACU = 0; ACC = 1; ACA = 10; ACG = 11]
8) ALA = [GCU = 0; GCC = 1 GCA = 10 GCG = 11]
9) TYR = [UAU = 0; UAC = 1]
-) STOP = [UAA = X, UAG = X; UGA = X]
10) HIS = [CAU = 0; CAC =1]
11) GLN = [CAA = 0; CAC = 1]
12) ASN = [AAU = 0; AAC = 1]
13) LYS = [AAA = 0; AAG = 1]
14) ASP = [GAU = 0; GAC = 1]
15) GLU = [GAA = 0; GAG = 1]
16) CYS = [UGU = 0; UGC = 1]
-) TRP = [UGG = X]
17) ARG = [AGA = 0; AGG = 1; CGU = 10; CGC = 11; CGA = 00; CGG = 01]
18) GLY = [GGU = 0; GGC = 1; GGA = 10; GGG = 11]

"Код умолчания" содержит гораздо меньший объем произвольно закодированной информации на пару оснований ДНК, чем суперкодированная ДНК, но "Код умолчания" действительно является очень "тихим" в биологическом смысле. Независимо от наличия или отсутствия "Кода умолчания" белковые структуры и взаимодействия, общее количество пар оснований, энергетические потребности клетки-хозяина остаются неизменными. "Код умолчания" - это следующий этап в развитии генного искусства, подразумевающий более высокий уровень организации творчества в этой области. Он дает возможность создать карту мира, которая имеет большее соответствие оригиналу, нежели сам оригинал.
Теоретически, при помощи "Кода умолчания" можно зашифровать все геномы всех живых организмов, не изменяя экологии их взаимодействия между собой или экологии окружающей среды в целом.
Первым объектом (работа продолжается) кодирования с использованием "Кода умолчания" стал плазмид pSK-M13+. В него введено стихотворение Гете о тишине и смерти ("Ночная песнь странника"):

Uber allen Gipfeln
Ist Ruh,
In allen Wipfeln
Spurest du
Kaum einen Hauch;
Die Vogelein schweigen im Walde
Warte nur, balde
Ruhest Duauch.***

Перевод с английского Юлии Шпаковой.

Библиографию статьи см. в английской версии. (Прим. ред.)

* Билатеральный - двусторонний, относящийся к обеим сторонам. (Прим. ред.)
** 3867 bp (base pairs = пар оснований) - этот размер в принципе соотносим именно с размером плазмид; размер же полного вирусного генома составляет около 30 000-50 000 bp. (Прим. ред.)
*** Мирно высятся горы.
В полусон
Каждый листик средь бора
На краю косогора
Погружен.
Птичек замерли хоры.
Погоди: будет скоро
И тебе угомон.
(Перевод стихотворения Б. Пастернака)




НА ГЛАВНУЮ    ENGLISH

Как заказать эту книгу

ВЫХОДНЫЕ ДАННЫЕ

СОДЕРЖАНИЕ:

I. МАСТЕРСКАЯ: наука и технологии

Светлана Боринская. Геномика и биотехнология: наука начала третьего тысячелетия.

Михаил Гельфанд. Вычислительная геномика: от пробирки к компьютеру и обратно.

Ирина Григорян, Всеволод Макеев. Биочипы как пример индустриальной биологии.

Валерий Шумаков, Александр Тоневицкий. Ксенотрансплантация: научные и этические проблемы.

Абрам Йойрыш. Правовые аспекты генной инженерии.

Павел Тищенко. Геномика: новый тип науки в новой культурной ситуации.
II. ФОРУМ: общество и геномная культура

Юджин Такер. Комната ожидания Дарвина.

Critical Art Ensemble. Биотехнология в общественном сознании: время обещаний.

SubRosa. Секс и гендер в век биотехнологий.

Рикардо Домингес. Неизбежность торжества нанотехнологий 3.0: фрагменты постбиотехнологической эры.

Биргит Рихард. Клоны и двойники. Тиражирование и воспроизведение "я" в кинообразах.

Свен Дрюль. Филогенез химер: от античности до наших дней.
III. ТОПОЛОГИЯ: от биополитики до биоэстетики

Борис Гройс. Искусство в эпоху биополитики.

Стивен Уилсон. Искусство и наука как культурные действия.

Мелентий Пандиловски. О феноменологии сознания, технологии и генетической культуре.

Рой Эскотт. Интерактивное искусство: на пороге постбиологической культуры.
IV. КОД ВЗАИМОДЕЙСТВИЯ: искусственная жизнь

Марк Бедо. Исследование гипертворчества человека с помощью технологии искусственной жизни.

Луи Бек. Искусственная жизнь под напряжением.

Алан Дорин. Виртуальные животные в виртуальных средах.

Криста Зоммерер, Лоран Миньоно. Использование принципов искусственной жизни в интерактивных компьютерных инсталляциях.
V. ТЕАТР НОВОГО ВРЕМЕНИ: ars genetica

Джордж Гессерт. История искусства с привлечением ДНК.

Кетлин Роджерс. Образ материи.

Брендон Балланже. Источники искусственного отбора.

Марта ди Минизиш. Лаборатория как мастерская художника.

Адам Заретски. Зоо-арт ломовой лошади и экзамен по биоэтике.
VI. ТЕХНОЛОГИЯ ОБРАЗА: ars chimaera

Джо Дэвис. Монстры, карты, сигналы и коды.

Дэвид Кремерс. Парадокс Дельбрюка. Версия 3.

Эдуардо Кац. Зеленый флуоресцирующий кролик.

Дмитрий Булатов. Искусство химер.

Валерий Подорога. Рене Декарт и Ars Chimaera.
VII. МЕТАБОЛА: искусство и культура ткани

Йонат Цурр. Усложненные понятия о жизни: "полуживые" существа.

Орон Каттс. Фрагменты конструирования жизни - влажная палитра тканевой инженерии.
VIII. P.S.

Дмитрий Пригов. Мы о том, чего сказать нельзя.

Галерея влажного искусства

Биографии

Библиография

Веблиография

Глоссарий


© кф гцси. евгений паламарчук | Jaybe.ru