Joe Davis ::: Biography

MONSTERS, MAPS, SIGNALS AND CODES

Naturalism in Art
Realistic treatments of human and animal subjects in neolithic cave paintings and petroglyphs clearly indicate that artists' obsession with naturalism dates back to the earliest examples of art making. Art of ancient civilizations of the Mediterranean and the Levant reflects a historic progression toward "perfect knowledge" of the human body itself. When the classical Greeks more or less achieved "perfect knowledge" of human surface anatomy, they turned to a search for deeper secrets of life. They measured proportions of the human body and derived a "Divine Proportion" which in turn, was applied to mathematics, architecture, and astronomy. Johannes Kepler's "Nested Solids," constructed to emulate these proportions, was used (perhaps serendipidously) to calculate a map of the movements of planets around the sun with surprising accuracy.

Transanimation in the History of Art (selected examples)
Accounts of divinely assisted or magically conjured interconversion or "transanimation" of all forms of animate and inanimate matter are important elements in Greco-Roman mythology and Judeo-Christian traditions. Both figure prominantly in the archives of human facination with the qualities of function and vitality that distinguish life and death.
The Greeks and Romans had Midas, Medusa, Arachne, Srynx, Daphne, and scores of other characters morphing or, "transanimating" back and forth from flesh and blood into gold, stone, river reeds, spiders, trees and many other exotic forms.

This on-line version of the book "Biomediale. Contemporary Society and Genomic Culture" is not full. The unabridged edition can be purchased in printed form as anthology. Requests should be sent to: bulatov@ncca.koenig.ru (full information) or in written form: 236000, Russia, Kaliningrad, 18, Marx str., The National Publishing House “Yantarny Skaz”. Phone requests: Kaliningrad +7(0112)216251, Saint-Petersburg +7(812)3885881, Moscow +7(095)2867666. On-line bookshop (in Russian): http://www.yantskaz.ru. Full reference to this book: "Biomediale. Contemporary Society and Genomic Culture". Edited and curated by Dmitry Bulatov. The National Centre for Contemporary art (Kaliningrad branch, Russia), The National Publishing House “Yantarny Skaz”: Kaliningrad, 2004. ISBN 5-7406-0853-7

Aliens and Monsters
Perhaps the most profound example of "transanimation" is the serious scientific search for extraterrestrial intelligence because we hope that by merely asking a question, we can bring the whole universe to life. Here too human imagination has been moved to repeat earlier themes. Popular hysteria about alien abductions are replete with sexual complications. There is both fear and anticipation.
An intriquing aspect of the transanimation stories is that they are almost always about horrible monsters that have romantic or sexual interactions with human beings. Yet, just as classical monstrosities all correspond to what we now understand to be examples of clinical pathology, it turns out that even our own modern monsters are inevitably, versions of ourselves. Perhaps this might help to explain why Star Trek's "Captain Kirk" had romantic liasons wth several non human species.
Composite, part human/part animal figures of the ancient Egyptian pantheon, the minotuar of Crete and the centuars of Greece and Rome all seem to have anticipated the spectre of inter-species monstrosity that haunts the anti-genetics lobby and activists concerned with genetically modified food. Yet, these chimeric "monsters" too have long existed in many, perhaps, unsuspected forms. Homo sapiens share many essential genes with the rest of terrestrial biology. We human beings, no matter how unique and gifted we imagine ourselves to be, have an approximate 70% genetic homology with tomatoes. Homo sapiens' genetic homology with chimpanzees and the great apes is closer to 99%.
It is somehow easy to overlook the fact that aliens and monsters have already completely overrun the planet. They are are numerous, ubiquitous and incognito and most of them have something to do with food.
Human beings have, since the beginning of Agriculture imparted their genetic preferences into the genomes of many different species. Essentailly all species related to agriculture have been genetically manipulated. Let's again take the tomato as an example, one that has been obtained say, at an "organic," "natural foods" grocery store. It has never been directly treated with chemical pesticides or fertilizers. Yet even this purest of tomatoes is a "monster" by dictionary definition [cite definition here?]. Tomatoes as we know them have many more copies of their chromosomes than their raisin-sized ancestor's normal compliment. The extra DNA in today's tomatoes means that many genes are translated over and over again which has had the effect of giantizing the original fruit. So, once upon a time, we made giant tomatoes. It makes little difference whether or not this modification of tomatoes was carried out with conventional horticultural techniques, use of mutagenic agents, or the recombinant techniques of molecular biology. The result is the same. Tomatoes are "monsters." Most people just don't know.
Even a rose is a Frankenstein in a sense, because it is comprised of pieces and parts of the genomic makeup of many other subspecies of roses. The same is true for essentially all ornamental plants and many other non-food organisms modified by Homo sapiens for their aesthetically pleasing qualities or by-products.
Over time, Human beings have not only been the creators of monstrosity, they have become the phages and/or consumers of the monstrosities they created. In so doing, they have indirectly modified themselves. If modern Homo sapiens had to survive on the ancestors of species that make up its current food supply, genetic "retrofits" would be called for. We would have to resupply ourselves with the phenotypes of earlier homonids simply to manage the collection and digestion of those materials.
It seems that not only have we been confused about who the monsters are, we expect everybody else (aliens) to be just as confused as we are.


Interplanetary probe Pioneer message plaque.

The Search
Whether or not it was our original intention, we have sent strangely incorrect pictures off into the cosmos explicitly to impersonate our species. These were rocketed out of the solar system on gold-plated message plaques with NASA Pioneer and Voyager interplanetary probes. They are reputed to be the first serious scientific attempts to communicate with alien species.
Launched in the early and mid 1970's, NASA's Pioneer and Voyager spacecraft acheived enough velocity to escape the solar system with an the assistance of the Jovian gravitaional field. They are the fastest ballistic objects ever created by human beings and are now travelling at about 1/20,000th light speed: many, many times faster than a speeding bullet.
Pioneer message plaques contain a collage of visual information including a rudimentary map of the solar system and the spacecraft's trajectory, a chart of quasi-stellar objects called "Pulsars" (which was intended to guide curious extraterrestrials back to vicinity of our solar system), an image of the Pioneer probe itself, and two line drawings intended to represent average male and female Homo sapiens. The represented figures are of well groomed Caucasians without facial or body hair. The male figure has a mysterious raised arm and open hand and "appropriately" represented genitals. The genital structures of the smaller female figure are conspicuously missing.
To make matters worse, NASA decided to completely eliminate all attempted representations of nude human beings from messages accompanying the two Voyager probes, the next spacecraft to leave the solar system. Clearly, such censorship was not undertaken for the benefit of aliens.
Obviously, we know very little about aliens. Still, if "intelligence" exists anywhere else in biological form, there is one thing we can be nearly certain of. That intelligent entity is very likey to be a sexual one because organisms must exchange genetic material in order to evolve. Joshua Lederberg was awarded the Nobel prize in 1958 for his discovery that even bacteria have sex.
As it stands, whether advertantly or inadvertantly, we have managed to send several messages into space that could be interpreted to speak very strongly about our own intolerance. Obvious deletions from our interstellar messages suggest that aliens aren't entitled to know what we look like. Perhaps we should not be so skeptical about reports that aliens are abducting people to experiment with their sex organs.
Perhaps fortunately, even though the Pioneer and Voyager spacecraft are the fastest artificial ballistic objects in history, at 1/20,000th light speed, it would take about 100,000 years for one of them to reach the nearest star. There is, however, a much speedier method to dispatch messages into space.
Astronomers Frank Drake and Carl Sagan decided to use the million-watt radar transmitter at Arecibo, Puerto Rico to beam a three-minute, light-speed message to the constellation Hercules in 1974.
Because of its inherent simplicity, Drake and Sagan reasoned that binary mathematics would be the most universally acceptable form of quantization. Futhermore, the two astronomers decided that if aliens knew about mathematics, they would also know about prime numbers and numbers mathematicians call, "Zormelo numbers." These are a family of numbers, like the number 35, that can only be divided by itself, 1, and the two prime factors (in this case, 5 and 7).
Drake and Sagan used the Arecibo radar to transmit a signal consisting of 1679 "ons" and "offs"(zeros and ones). 1679 is a Zormelo number that can only be factored by itself, 1 and the prime numbers 23 and 73. Thus, intelligent aliens would deduce that the stream of 1679 bits must be compiled into a 23 by 73 rastar grid. If the "zeros" and "ones" are assigned contrasting values (e.g., "light" and "dark"), then in one of several possible 23 by 73 compilations, the intended image appears. Finally, with one more leap of faith, the alien interprets intended information from the assembled graphic.
Like the Pioneer plaques, the correctly interpreted Arecibo radar message contained a picture of its vehicle(the Arecibo radar dish); a rudimentary map of the solar system and a crude representation of human beings (a single stick figure). The Arecibo message also contained a representation of the right-handed DNA helix, the atomic weights of its five constituent chemical elements, the approximate number of DNA bases in the human genome, and a 1974 world population estimate.


Launched in the early 1970's, NASA's Pioneer spacecraft acheived enough velocity to escape the solar system with an the assistance of the Jovian gravitaional field.

Message in Many Bottles
In 1989, I installed one of my several artworks inspired by the Arecibo message at Hayden Library at MIT. The art work, entitled Message in Many Bottles, consisted of 1679 generic, Boston Round 16-ounce glass bottles with phenolic caps mounted in large partitioned racks. "Ones" were water-filled bottles; "Zeros" were empty. The installation occupied 18 aisles of library space in the basement "stacks" of the library. Hayden is one of MIT's largest libraries. It contains all of the information the message refers to; all of the information needed to decode the message; and supposedly better than average terrestrial intelligence frequently visit the library. No one decoded the message.

This on-line version of the book "Biomediale. Contemporary Society and Genomic Culture" is not full. The unabridged edition can be purchased in printed form as anthology. Requests should be sent to: bulatov@ncca.koenig.ru (full information) or in written form: 236000, Russia, Kaliningrad, 18, Marx str., The National Publishing House “Yantarny Skaz”. Phone requests: Kaliningrad +7(0112)216251, Saint-Petersburg +7(812)3885881, Moscow +7(095)2867666. On-line bookshop (in Russian): http://www.yantskaz.ru. Full reference to this book: "Biomediale. Contemporary Society and Genomic Culture". Edited and curated by Dmitry Bulatov. The National Centre for Contemporary art (Kaliningrad branch, Russia), The National Publishing House “Yantarny Skaz”: Kaliningrad, 2004. ISBN 5-7406-0853-7

Zero wasn't invented on our own planet until about a thousand years ago. Presumably intelligent creatures who built Parthenon, the aquaducts of Rome, the pyramids of Egypt and those who first mapped the stars and calculated the Earth's circumference did so without the use of zero at all.
Another problematical preconception is that scientists' dependency on visual information for intersellar communications, whether in the form of rastared pixel arrays or message plaques presumes alien visual sensory organs will be available to view those messages. On our own planet, Kent Cullers, now at the SETI Institute in California, and who for many years was one of NASA's principal investigators devoted to the search for extraterrestrial intelligence, is a blind man.


Frank Drake and Carl Sagan decided to use the million-watt radar transmitter at Arecibo, Puerto Rico to beam their message.

Poetica Vaginal
In 1986, I organized an artistic project to transmit vaginal contractions into space to communicate with extraterrestrial intelligence. The project, called Poetica Vaginal, involved artists, mechanical and electrical engineers, biologists, astronomers, professional dancers, architects, linguists and philosophers.
A "vaginal detector" was built in a laboratory of mechanical engineering and consisted of a water-filled polyallomer centrifuge tube mounted on a hard nylon base that contained a very sensitive pressure transducer. Dancers and other female volunteers (unsolicited) hygienically invaginated the detector in order to characterize vaginal contractions (the fastest was clocked at 0.8 Hz). The embedded pressure transducer was sensitive enough to detect voice, heartbeat, and respiration as well as voluntary and involuntary vaginal contractions.
Electronic music software was used to generate real time harmonics of vaginal contractions until that frequency matched one of the frequencies in the set of unique frequencies of English speech. A collaborating linguist bit-mapped those speech sounds (called, "phonemes") so that they could be generated in real time corresponding to vaginal "inputs." A digital map of the analog detector output was also made in real time. Thus, three forms of the message were simultaneously generated: 1) an analog signal directly generated by vaginal contractions; 2) a digital map of same and 3) voice (English phoenetic maps of vaginal contractions).
Collaborating electrical engineers built gating circuits so that Poetica Vaginal signals could be transmitted from MIT's million-watt Millstone Radar transmitter at Haystack Observatory in Groton/Westford, Massachusetts.
Artists, architects and mechanical engineers collaborated in the construction of a "Vaginal Excursion Module" to contain electronics and human operators at the transmission site. A folding structure made of steel, cable, wood, and thatch materials, the Vaginal Excursion Module looked rather like a Native American "sweat lodge" mounted on a Mars lander.




Artistic work constructed from synthetic molecules of DNA. The first of these artistic molecules, Microvenus, contains a coded visual icon representing the external female genitalia and by coincidence, an ancient Germanic rune representing the female Earth.

Astronomers and astrophysicists collaborated in the selection of 4 nearby sunlike stars: Epsilon Eridani, Tau Ceti and two unnamed sunlike (G-type) stars with RGO (Royal Greenwich Observatory) catalog numbers. These stars are from 10 to 40 light years distant. Their positions (right ascension and declination) were calculated so that radar signals could be targeted. The Vaginal Excursion Module was assembled at Haystack and preliminary test transmissions of vaginal signals were undertaken with sample vaginal signals recorded on audio tape. Then, on the eve before live broadcasts were to be made, the Millstone project Group Leader, a United States Air Force Colonel (Millstone Radar had been contracted tothe Air Force by MIT) terminated the project. Still, a few minutes of test transmissions were made to each of the four sunlike stars.

Slow Boats and Other Problems
Like spacecraft-based experiments, radar transmission experiments in interstellar communications also have significant problems to overcome. There are no powerful radar transmitters in space so transmissions must be sent through the relatively dirty window of atmosphere. This effectively narrows the range of frequencies that can be transmitted.
Millstone radar was a convenient choice of transmission instruments for the Poetica Vaginal project not only because it is an MIT facility (a number of the Poetica Vaginal collaborators were affiliated with MIT), but also because it is one of the few radar transmitters that can generate powerful signals at frequencies which sunlike stars make only relatively weak signals of their own.. A million-watt radar signal between 1 and 10 gigahertz is "bright" enough to outshine the sun. That is, a megawatt signal is enough to make the sun appear to be "brighter" at those particular frequencies than any other G-type star.
However, this only works when the receiving entity happens to be located precisely in the center of the transmitted beam of radio photons (i.e., at the center of the columnated radar signal). Because radar waves are photons and photons diverge (according to the "inverse square law") like the focused beam of photons from an automobile headlight or a hand-held flashlight, the radiated signal incident on a receiver drops off dramatically with distance from the center of the beam. Over interstellar distances, targeting must be extremely precise.
There are from 200 to 400 billion stars in our local galaxy and a significant percentage of these are G-type (sunlike) stars. Owing to technical limitations, radar transmissions can only be made to one star at a time. To put this in perspective, we can note that there are many more stars in the Milky Way than there are fish in the ocean. One day we decide to go fishing for only three minutes. We hope that we are successful but we are only equipped to catch one particular fish in an ocean full of fish. Our chances for success are extremely slim.
The biggest problem with high-speed messages for extraterrestrial intelligence is that at cosmic scales, even light-speed messages are very slow "boats." The Milky Way Galaxy is approximately 100,000 light-years in diameter. A transit from one side to the other and back again equals a 200,000 year round trip at the speed of light. The "mitochondrial Eve" (from which all living human beings are said to be decended) lived approximately 200,000 years ago. If the mitochondrial Eve had somehow obtained the facilities needed to transmit a signal at the right frequency and with enough power to the other side of our own galaxy and that signal was received at the right moment 100,000 years ago by an alien intelligence who immediately beamed a corresponding message back in our direction, well, that message might not have arrived yet. Meanwhile, Eve evolves into another species. The mitochondrial Eve was probably not Homo sapiens.
The radar dish at Arecibo is not highly manueverable because it is built into the hemispherical depression that comprises an extinct volcanic crater. Signals transmitted from there can therefore only be aimed through a limited window. Sagan and Drake had to choose from stars appearing in that window at the time they transmitted their interstellar message. As a result, the light speed message transmitted from Arecibo was beamed to a group of stars in the constellation Hercules that lie about 25,000 light-years away. So, here we are, waiting in the chapel with fresh flowers for the spouse for 50,000 years: nude decending and decending and decending the staircase, bachelors waiting and waiting and waiting to strip the bride bare. It is tragic indeed.
Aside from any problems having to do with message content, 3 basic technical problems remain that surface in all experimental interstellar communications projects. First, billions of message copies are needed for billions of possible receivers. Second, the message carrier must be robust enough to survive harsh extremes of the space environment including thermal extremes, radiation and vacuum. Third, for practical purposes, the integrity of the message carrier must remain intact indefinitely (at least for periods of time that are equivalent to periods we call, "geologic time").
These are the problems that stitch together the vastness of the macrocosmos with the infinitesimal minutae of the microcosm and they inspired my first artistic projects in
molecular biology. It so happens that bacteria, especially sporulating bacteria, can cope with the criteria of these three problems very well. They have been shown to survive the space environment for extended periods of time and can probably do so indefinitely. Many billions of exact copies of a single bacterium can be conveniently and inexpensively produced overnight.

Microvenus
In 1986, two of the Poetica Vaginal collaborators (myself and Dana Boyd, a Harvard geneticist and molecular biologist) decided to create a model bacterial carrier of human intellectual information. This work, called Microvenus, became the first work of art to be created with the recombinant tools of molecular biology and the first artwork to be created directly in the form of DNA (Davis 1996). Microvenus consists of a graphic icon(like a "Y" and an "I" superimposed) that was coded into a sequence of DNA nucleotides. The sequence was synthesized with Martin Bottfield at Harvard. The resulting synthetic oligonucleotides were purified at UC Berkeley with Dana Boyd and later transformed at Harvard with laboratory strains of E. coli by single-strand, blunt-end ligation with pUC19 and pSK-M13+ plasmid vectors.
Microvenus was the first of several artworks that employ increasingly complex strategies to artificially encode human knowledge into DNA. We assigned a set of phase values to the four DNA bases(C=x; T=xx; A=xxx; G=xxxx) in order to code the Microvenus icon. This strategy was combined with Zormelo rastar mapping technique used by Drake and Sagan to compose the Arecibo message. Microvenus was coded into a 35-bit (7-bit by 5-bit) Zormelo rastar containing the icon:

10101
01110
00100
00100
00100
00100
00100





Art work allows the user to listen particular living cells microacoustic signatures

Using phase value assignments for the four DNA bases, the number comprising this binary rastar can be expressed as "CCCCCCAACGCGCGCGCT". The first binary digit on the upper left (top row) can be expressed as "C" because that number has a single phase because it is not immediately repeated. It remains in the same state ("1") a single time before switching to the other binary digit. The second third and fourth digits in the second row can be expressed as a single "A" because that number ("1") repeats three times before switching to the other binary digit. The next four binary digits can be expressed as "G". In this way, the 35-bit Microvenus rastar is coded into 18 DNA bases. In addition, a short sequence, "CTTAAAGGGG", was added as a decoding clue (referring to the DNA base-to-phase value assignments). The combined 28-mer Microvenus DNA sequence, reads "CTTAAAGGGGCCCCCCAACGCGCGCGCT".
The Microvenus icon is both an ancient Germanic rune for the female Earth and a graphic representation of genitalia heretofore censored from messages to extraterrestrial intelligence. No provision was ever made to disseminate Microvenus bacteria into space and so to risk contamination of extraterrestrial environments with terrestrial bacteria. But Microvenus bacteria, perhaps as Bacillus spores, would have significant advantages over radar and spacecraft as carriers of messages for extraterrestrial intelligence.
Whether or not Microvenus or any other message-carrying bacteria are ever deployed in space, the contamination of extraterrestrial environments is now practically inevitable. Mercury, Gemini, Apollo, Skylab, and Space Shuttle spacecraft have all discharged human metabolic wastes directly into space. They have literally flushed their toilets there.
Cosmic dust researchers complain bitterly because in attempts to collect particles from extraterrestrial and interstellar space, investigators must now sift through impacts of astronaut urine and feces (shown to match spectra of urine and feces samples obtained in the laboratory). Space Shuttle itself has had to have human wastes cleaned off its windsheild.
I have used "poetic license" to name these belts of frozen sewage that surround the Earth "The Norton Rings"(a planetary object must have two or moons to form true "rings" like those encircling the planet Saturn). The "Norton" namesake was inspired by the character of "Ed Norton" (played by Art Carney) a sewer worker, in the 1950's American television series "The Honeymooners."


Fig.1. Delbruck Riddle of Life RNA code (ABCD=UCAG).

The Riddle of Life
In the early 1990's I discovered that some scientists had thought about writing messages into DNA some 30 years before the Microvenus organism was made. I found two books that made minor references to this little known episode in the history of science (Ernst and Lipson 1988; Beadle and Beadle 1966). The events took place in the year 1958.
Watson and Crick (with the help of Rosalin Franklin) had resolved the structure of DNA some 5 years earlier but nearly another decade would elapse before scientists resolved the working details of the genetic code. The triplet-codon operational aspects of DNA were known but the distribution of the twenty amino acids according to their representations by the 64 possible nucleotide triplets was not resolved until 1967. In the interim, biologists realized that the operation of the genetic code was in many ways similar to the operation of natural blanguage. A given triplet codon has as much to do with the amino acid it represents as say, the word "red" has to do with the phenomenon or perception of the color red. In this way, the genetic code works like blanguage in the formal, linguistic sense and when scientists discovered this, they waxed just a little bit poetic. For a few years there were even arguments in the halls of biology about whether or not there were "spaces" between the "words." Biologists designated these competing views as"comma-" and "comma-free" codes. Once again, science had reached the limits of understanding and found ist own blanguage reflected there.

This on-line version of the book "Biomediale. Contemporary Society and Genomic Culture" is not full. The unabridged edition can be purchased in printed form as anthology. Requests should be sent to: bulatov@ncca.koenig.ru (full information) or in written form: 236000, Russia, Kaliningrad, 18, Marx str., The National Publishing House “Yantarny Skaz”. Phone requests: Kaliningrad +7(0112)216251, Saint-Petersburg +7(812)3885881, Moscow +7(095)2867666. On-line bookshop (in Russian): http://www.yantskaz.ru. Full reference to this book: "Biomediale. Contemporary Society and Genomic Culture". Edited and curated by Dmitry Bulatov. The National Centre for Contemporary art (Kaliningrad branch, Russia), The National Publishing House “Yantarny Skaz”: Kaliningrad, 2004. ISBN 5-7406-0853-7

Permission was obtained from Harvard's Biosafety Committee and the Cambridge (Massachusetts) Biosafety Committee to install the Riddle of life E. coli in a locking, double-glass fronted refrigerator that was obtained for that purpose and installed in Harvard's Boylston Hall.
The journal Nature published a page-long article about the Harvard Riddle of Life exhibition which suggested that we had built a "bridge between two cultures" of science and art. Unfortunately however, we didn't quite make it all the way across the bridge. (Nadis 1995)

Regulatory Issues of Production, Exhibition and Public Display of Genetic Art
In a last minute "clarification," Harvard's Biosafety Committee reversed their initial permission to install Riddle of life E. coli in the refrigerator in Boylston Hall. This finding was made in spite of the fact that Scientific American had recently nationally published a do-it-yourself "Amateur Scientist" column instructing hobbyists about how to create their own recombinant E. coli at home in an aquarium with a light bulb incubator.
Five years later, Riddle of life organisms were finally displayed publically in special enclosures at Ars Electronica 2000 in Linz, Austria. (Nadis 2000). Arrangements for physical and biological containment were made with full authorization and oversight of Austrian biosafety officials.
Genetic artists who choose to manipulate the DNA of living organisms must obviously confront significant technical, architectural, climate-control and biosafety issues connected with public display of recombinat organisms. The same is of course true for curators who choose to mount such exhibitions in publically-accessible venues. Gallery and museum operators have often found themselves unable or unwilling to undertake the challenges that are required for the handling and display of genetic (genetically-modified) art. Daunting security and liability issues must be overcome. Curators are also concerned with founded and/or unfounded public hysteria about genetic manipulation in general and the attitude of the press.
In the laboratory, organisms are relegated to increasing levels of containment based on how dangerous they are perceived to be to other organisms (including human beings). Organisms like E. coli (the human intestinal bacterium) were chosen to become the workhorses of biology because they normally coexist with human beings without any attending pathology.
Although they comfortably coexist with human beings, E. coli make bacteriotoxins which are harmful to other bacteria (a fact that human beings may depend on because E coli also kills pathogenic organisms). This accounts for their overwhelming majority among bacterial populations of the human intestinal tract. In fact, E. coli are crawling all over us most of the time. They are found inside and outside of human beings everwhere human beings themselves are found.

This on-line version of the book "Biomediale. Contemporary Society and Genomic Culture" is not full. The unabridged edition can be purchased in printed form as anthology. Requests should be sent to: bulatov@ncca.koenig.ru (full information) or in written form: 236000, Russia, Kaliningrad, 18, Marx str., The National Publishing House “Yantarny Skaz”. Phone requests: Kaliningrad +7(0112)216251, Saint-Petersburg +7(812)3885881, Moscow +7(095)2867666. On-line bookshop (in Russian): http://www.yantskaz.ru. Full reference to this book: "Biomediale. Contemporary Society and Genomic Culture". Edited and curated by Dmitry Bulatov. The National Centre for Contemporary art (Kaliningrad branch, Russia), The National Publishing House “Yantarny Skaz”: Kaliningrad, 2004. ISBN 5-7406-0853-7

Whether or not scientists rigorously abide with biosafety protocols, artists must carefully observe them. There are in fact, no protocols in place for the disposition of genetically engineered organisms that are used in the production of art. As a result, some scientific workers may feel that only other scientific workers can safely handle recombinant materials. In fact, science has no particular franchaise on responsible conduct. Yet artists must depend on collaborating scientific laboratories for the production of genetic artworks because so far, no artist has set up an independent laboratory dedicated to the creation of recombinant organisms strictly for art's sake. Responsibility for the disposition of organisms outside of a laboratory would normally entail the culpability of the laboratory where such organisms were produced. Artists can expect to encounter some scientific anxiety surrounding the production of genetic artwork. Moreover, for obvious reasons, artists working in scientific laboratories must observe scientific protocols or they will quickly lose access to those facilities.






Joe Davis, Katie Egan. Artistic Molecules & Audio Microscope (installation fragment), 2000. Photo by S. Starmayr. Art work constructed from synthetic molecules of DNA: Audio Microscope allows the user to image particular living cells while simultaneously listening to their greatly amplified - and species-specific - microacoustic signatures. The project Riddle of Life, which likewise works with sequencing and back-translation, takes the poetic message "I am the riddle of life. Know me and you will know yourself."


Genomic Art

In a relatively short period of time artists have moved from the traditions of naturalism as mimetic represtntation to the direct manipulation of life itself. To date, the level of these artistic manipulations has been concerned with single genes (or the equivalent thereof) and their expression or disposition within the cells of host organisms.
In the course of time, artists involvement with the techniques of molecular genetics and molecular biology can be expected to increase as the technology itself and understandings of genetics and now, human genomics also advance. Soon, works of art will be created at the scale of many genes, and even of whole genomes.
Genomes are large reservoirs of highly organized information that have elaborate, built-in or self-generated systems for data interpretation and analysis. Since these systems are made of nucleic acids and proteins, they operate with a level of sophistication that has never been included in the kind of straightforward mathematical operations used to handle conventional databases.
Art that consists of large, randomly-compiled DNA sequences cannot be automatically replicated in vivo. Large numbers of simple repeats of a single or of a few DNA base-pairs are biologically unstable. Some sequences can have properties that lead to instability and can even be toxic to host cells.
Genomic art, and even genetic art at a larger scale must be able to encode large amounts of arbitrary information into "biologically-friendly" DNA molecules. The DNA supercodes were designed for this purpose.

Supercodes and the Milky Way DNA
I created the first DNA supercode [Fig. 2] in 1995 for the purpose of encoding a map of the Milky Way Galaxy into a molecule of DNA. (Davis 2000)



Fig. 2. Key for a Base-20 Degenerate DNA Supercode.


The Milky Way Map is about a 1.1 kilobyte digital picture file containing the NASA Cosmic Background Explorer (COBE) map of the Milky Way which can be represented as a string of binary digits.
The supercode uses most of the 64 nucleotide triplets to represent base 20 numbers which are used to code the input information (in this case, the COBE map). A second level of coding is used to solve biological problems associated with coding of arbitrary data directly into DNA. The three termination or "stop" codons (TAA, TGA, and TAG) are reserved to function as "switches" between different coding modes and to specify mononucleotide simple repeats that appear in the input data. The four mononucleotide triplets (CCC, TTT, AAA, and GGG) are used to specify corresponding DNA Bases (C, T, A, and G).
The DNA supercode has three coding modes: 1) "TGA" is used to indicate biologically compatible segments of input data that is directly coded into DNA 2) "TAA" is used to indicate mononucleotide repeats where a tripletb invoking a base 20 number preceeds one of the triplets indicating a particular DNA base. 3) "TAG" is a non-coding or "delete" mode indicating that a sequence does not contain input data. TAG-specified sequences can contain recognition sites for enzymes needed for manipulation and assembly of the complete sequence, or for the insertion of essential functional genes to facilitate the stability of a completely assembled sequence in vivo.
The first step in supercoding a given database uses the TAA-mode to encrypt all termination codons appearing in input data that has been directly coded into DNA. All termination codons inserted as supercode mode-switching elements are deleted in the decoding process. Codons that can initiate translation (ATC, GTG, TTG, CTG, ...etc.) of input data by host cell biological machinery may also be encrypted in order to prevent undesired expression in vivo.
Supercode, like the genetic code itself, is highly degenerate so that a large number of DNA sequences could be generated that could each be decoded into exactly the same input data. In the case of the Milky way DNA for instance, many more sequences could be generated that contain the map of the galaxy than the number of stars it actually contains.
My inspiration to create the Milky way DNA was a childrens' story about a spoiled child who could find no happines until she met a mouse with a map of the world in its ear.
The first Milky Way DNA was synthesized in 2002 an installed at the Biologia Como Arte exhibition (Queiroz 2002) in Barcarena, Portugal (2002). The entire Milky Way DNA sequence comprises a 3867 bp DNA molecule that is larger than many plasmids and is the approximate size of many complete viral genomes.


Joe Davis. She (DNA) is the Primordial Venus. DNAgraphy, 2002. Microscopic images created with biochip technology (Clondiag Biochip Technologies GmbH, Jena) using DNA as photographic "emulsion". The technique allows for photography much as we think of it, but at extremely high resolution. The images are smaller than 1.0 mm.

Silent Code
DNA supercode solves many of the problems associated with encoding very large databases into DNA. One significant problem remains, however. An organism will tend to delete a DNA sequence that serves no significant biological purpose.
Dana Boyd and I have recently created a next-generation code called Silent Code that uses the degeneracy of the genetic code to insert arbitrary information into the coding sequence of a gene without altering the biological transcript of that gene. Encoded arbitrary information will not be rearranged or deleted by a host organism so long as it resides within the coding sequence of an essential gene.
The silent code uses codons that represent 18 of the 20 amino acids in the genetic code (44 of 64 codons). Each of these 18 amino acids are represented by 2 to 6 triplet codons in the code. (18 codon sets corresponding to 18 of 20 amino acids). Each of these codons is assigned a binary number value in the Silent Code. Codon sets of two triplets are assigned the values "0" and "1". The codon set containing three triplets is assigned "0", "1", and "00" values. Codon sets of four triplets are assigned the values "0", "1", "10" and "11". Sets of 6 codons are assigned "0", "1", "10" "11" "00" and "01" values.
Termination codons (TAA, TGA, and TAG) and the single codon sets for methionine and tryptophan (ATG and TGG) are not used in the Silent Code. [Fig. 3]

[Fig. 3] Silent Code

amino acid [codon = silent code value]

1) PHE = [ UUU = 0, UUC = 1]
2) LEU = [UUA= 0, UUG = 1; CUU = 10; CUC = 11; CUA = 00; CUG = 01]
3) ILEU = [AUU = 0; AUC = 1; AUA = 00]
-) MET = [AUG = X]
4) VAL = [GUU = 0; GUC = 1; GUA = 10; GUG = 11]
5) SER = [AGU = 0; AGC = 1; UCU = 10; UCC = 11; UCA = 00; UCG = 01]
6) PRO = [CCU = 0; CCC = 1; CCA = 10; CCG = 11]
7) THR = [ACU = 0; ACC = 1; ACA = 10; ACG = 11]
8) ALA = [GCU = 0; GCC = 1 GCA = 10 GCG = 11]
9) TYR = [UAU = 0; UAC = 1]
-) STOP = [UAA = X, UAG = X; UGA = X]
10) HIS = [CAU = 0; CAC =1]
11) GLN = [CAA = 0; CAC = 1]
12) ASN = [AAU = 0; AAC = 1]
13) LYS = [AAA = 0; AAG = 1]
14) ASP = [GAU = 0; GAC = 1]
15) GLU = [GAA = 0; GAG = 1]
16) CYS = [UGU = 0; UGC = 1]
-) TRP = [UGG = X]
17) ARG = [AGA = 0; AGG = 1; CGU = 10; CGC = 11; CGA = 00; CGG = 01]
18) GLY = [GGU = 0; GGC = 1; GGA = 10; GGG = 11]

The Silent Code contains less arbitrarily encoded information per DNA base-pair than supercoded DNA but the Silent Code is indeed very "quiet," biologically. Protein structures and interactions, overall number of base-pairs, and the energy requirements of a host cell remain essentially the same with or without Silent Coded information. Silent Code is a more sublime genetic art than the artforms that preceeded it. It is a way to draw a map of the world that exactly coinsides with itself, that is itself.
Theoretically all genomes of all living things could be encrypted with the Silent Code without altering the ecology of their interactions with one another or the environment as a whole.
The first Silent Coded entity (a work in progress) is the pSK-M13+ plasmid which contains a poem about silence and death by Goethe (Wanderer's Nightsong):

Uber allen Gipfeln
Ist Ruh,
In allen Wipfeln
Spurest du
Kaum einen Hauch;
Die Vogelein schweigen im Walde
Warte nur, balde
Ruhest Duauch.

References:
Guiseppe Archimboldo (Jewgani)
Beadle, G.W., Beadle, M. The blanguage of life; an introduction to the science of genetics (Garden City, N.Y.: Doubleday, 1966).
(Bible references) Exodus, Luke 7:11-17, 8:40-56, John 11:11-44.
(ref: Stanley Cohen).
Davis, J. (1996) "Microvenus," in: Levy, E. K., Sichel, B. M. (eds.) Art Journal 55:1, pp. 70-74.
Davis, J. "Romance, supercodes and the Milky Way DNA, " in: Stocker, G., and Schopf, Ch. (eds) Ars Electronica 2000 catalog: Next Sex (Vienna: Springer Verlag, 2000), pp.217-235.
Active Polio Virus Baked From Scratch Science 297; 12 July 2002.
Fischer, E. P., Lipson, C. Thinking about science: Max Delbruck and the origins of molecular biology (New York: Norton, 1988).
Nadis, S. (1995) "Genetic art' builds cryptic bridge between two cultures," in: Nature 378: 229.
Nadis, S. (2000) "Science for Arts Sake," in: Nature 407:668-670
Queiroz, I. P. "A Biologia Ao Servico Da Arte," in: A Capital, 19 May 2002




HOME    РУССКИЙ

How to purchase this book

COLOPHON

CONTENTS:

I. LABORATORY: science and technology

Svetlana Borinskaya. Genomics and Biotechnology: Science at the Beginning of the Third Millennium.

Mikhail Gelfand. Computational Genomics: from the Wet Lab to Computer and Back.

Irina Grigorjan, Vsevolod Makeev. Biochips and Industrial Biology.

Valery Shumakov, Alexander Tonevitsky. Xenotransplantation as a Scientific and Ethic Problem.

Abraham Iojrish. Legal Aspects of Gene Engineering.

Pavel Tishchenko. Genomics: New Science in the New Cultural Situation.
II. FORUM: society and genomic culture

Eugene Thacker. Darwin's Waiting Room.

Critical Art Ensemble. The Promissory Rhetoric of Biotechnology in the Public Sphere.

SubRosa. Sex and Gender in the Biotech Century.

Ricardo Dominguez. Nano-Fest Destiny 3.0: Fragments from the Post-Biotech Era.

Birgit Richard. Clones and Doppelgangers. Multiplications and Reproductions of the Self in Film.

Sven Druehl. Chimaera Phylogeny: From Antiquity to the Present.
III. TOPOLOGY: from biopolitics to bioaesthetics

Boris Groys. Art in the Age of Biopolitics.

Stephen Wilson. Art and Science as Cultural Acts.

Melentie Pandilovski. On the Phenomenology of Consciousness, Technology, and Genetic Culture.

Roy Ascott. Interactive Art: Doorway to the Post-Biological Culture.
IV. INTERACTION CODE: artificial life

Mark Bedau. Artificial Life Illuminates Human Hyper-creativity.

Louis Bec. Artificial Life under Tension.

Alan Dorin. Virtual Animals in Virtual Environments.

Christa Sommerer, Laurent Mignonneau. The Application of Artificial Life to Interactive Computer Installations.
V. MODERN THEATRE: ars genetica

George Gessert. A History of Art Involving DNA.

Kathleen Rogers. The Imagination of Matter.

Brandon Ballengee. The Origins of Artificial Selection.

Marta de Menezes. The Laboratory as an Art Studio.

Adam Zaretsky. Workhorse Zoo Art and Bioethics Quiz.
VI. IMAGE TECHNOLOGY: ars chimaera

Joe Davis. Monsters, Maps, Signals and Codes.

David Kremers. The Delbruck Paradox. Version 3.0.

Eduardo Kac. GFP Bunny.

Dmitry Bulatov. Ars Chimaera.

Valery Podoroga. Rene Descartes and Ars Chimaera.
VII. METABOLA: tissue culture and art

Ionat Zurr. Complicating Notions of Life - Semi-Living Entities.

Oron Catts. Fragments of Designed Life - the Wet Palette of Tissue Engineering.
VIII. P.S.

Dmitry Prigov. Speaking of Unutterable.

Wet art gallery

Biographies

Bibliography

Webliography

Glossary


© ncca kb. yevgeny palamarchuck | Jaybe.ru